Le défi:

Créez une fonction qui trouve le plus long palindrome à l'intérieur d'une chaîne.

^{Remarque: il s'agit d'une question à la traîne de code . S'il vous plaît ne prenez pas la question et / ou les réponses au sérieux. Plus d'informations ici .}

Aller

La solution suivante dans Go utilise les pouvoirs cachés de la simultanéité, des fermetures et de la récursivité pour trouver le plus long palindrome à l'intérieur d'une chaîne donnée:

func lp(s string) string {
    for i, l := 0, len(s); i < l; i++ {
        if s[i] != s[l-i-1] {
            a, b := make(chan string), make(chan string)
            go func() {
                a <- lp(s[:l-1])
            }()
            go func() {
                b <- lp(s[1:])
            }()
            c, d := <-a, <-b
            if len(c) > len(d) {
                return c
            }
            return d
        }

    }
    return s
}

De plus, il repose entièrement sur les primitives de langage et les types intégrés (pas de bibliothèque standard), c'est ainsi que vous reconnaissez un logiciel de vraie qualité.

Vous voudrez peut-être modifier légèrement la taille de votre thread, de votre mémoire et de votre pile pour les chaînes d'entrée plus volumineuses - c'est parce que cette solution est si rapide que votre système d'exploitation deviendra jaloux.

Edit - Perks:

• totalement inutile sur les chaînes de caractères multi-octets.
• n'omettra pas les signes de ponctuation ou d'espacement.
• omet l'égalité minuscule / majuscule.
• fonctionne dans un temps difficile à calculer - très lent, cependant.
• engendre beaucoup, beaucoup de goroutines, en fonction de l'entrée.
• est tué pour épuisement de la mémoire après quelques secondes sur ma machine avec plus de 16000 goroutines 2049186 générés pour l'entrée"345345ABCDEabcde edcbaDEABC12312123"

Python

def longest_palindrome(s):
    return 'racecar'

Exemple d'utilisation:

>>> print longest_palindrome('I like racecars!')
racecar

Remarque: cela peut ne fonctionner que pour certaines chaînes.

De toute évidence, la vérification des Palindromes est difficile.

La solution est donc assez simple: générez un ensemble de tous les palindromes possibles aussi grands que la chaîne que vous testez et voyez si votre chaîne en contient.

C #

string largest = String.Empty;

    for(int i=0; i < myString.lenght; i++)
    {

//Don't use the newfangled stringbuilder. Strings are awesome
char[] testString = new char[i];

    for (int charPosition=0; charPosition < i/2; charPosition++)
    {
    for (char c = 'A'; c <= 'Z'; c++)
    {
       if ((charPosition/i) == i/2)
{
//middle one
testString[i] = c;
} 
else 
{
//do one for that position, and the lenght-position
testString[i] = c;
testString[testString.length - i] = c;
}

if (myString.Contains(testString.ToString())
{
//yaay
largest = testString.ToString();
}


{

}
    } 

}


}

(J'aurais peut-être besoin de vérifier l'exactitude de mon code, mais sinon, c'est un moyen extrêmement horriblement inefficace de rechercher des Palindromes)

Perl

Est-ce que tout a demandé. C'est en fait mieux, car il prend en compte toutes les sous- séquences possibles . Quel est le piège? Il fonctionne en temps exponentiel, ainsi chaque caractère supplémentaire dans la chaîne double le temps d'exécution. Donnez-lui plus de 20 caractères et cela prendra toute la journée.

$inputstring = <>;
@arrayofcharacters = split("",$inputstring);
for(0..2**length($inputstring)-1){
 $currentsubsequence = "";
 @choice=split("",sprintf("%b",$_));
 for(0..$#arrayofcharacters){
  $currentsubsequence .= "$arrayofcharacters[$_]" x $choice[$_];
  if($currentsubsequence eq reverse($currentsubsequence)){
   $palindromes{length($currentsubsequence)} = $currentsubsequence;
   $palindromes[~~@palindromes] = length($currentsubsequence);
  }
 }
}
print($palindromes{@{[sort(@palindromes)]}[$#palindromes]})

Entrée: iybutrvubiuynug. Sortie: ibutubi.

Entrée: abcdefghijklmnopqrstuvwxyzzyxwvutsrqponmlkjihgfedcba. Sortie: n'arrivera pas

Votre problème est facilement résolu par les expressions régulières, comme dans l'image ci-dessous (mais j'ai décidé d'utiliser Java au lieu de cela). Cela se produit car regex est toujours le meilleur outil qui puisse être utilisé pour tout ce qui implique d'extraire ou d'analyser du texte.

package palindrome;

import java.util.regex.Pattern;
import javax.swing.JOptionPane;

public class RegexPalindrome {

    private static String next(String now) {
        if (now.isEmpty()) return "a";
        String prefix =  now.length() == 1 ? "" : now.substring(0, now.length() - 1);
        if (now.endsWith("z")) return next(prefix) + "a";
        return prefix + String.valueOf((char) (now.charAt(now.length() - 1) + 1));
    }

    public static void main(String[] args) {
        String text = JOptionPane.showInputDialog(null, "Type some text:");

        String bestPalindromeFound = "";

        for (String searchText = "a"; searchText.length() <= (text.length() + 1) / 2; searchText = next(searchText)) {
            String reverse = new StringBuilder(searchText).reverse().toString();
            if (searchText.length() * 2 - 1 > bestPalindromeFound.length()) {
                Pattern p = Pattern.compile(".*" + searchText + reverse.substring(1) + ".*");
                if (p.matcher(text).matches()) bestPalindromeFound = searchText + reverse.substring(1);
            }
            if (searchText.length() * 2 > bestPalindromeFound.length()) {
                Pattern p = Pattern.compile(".*" + searchText + reverse + ".*");
                if (p.matcher(text).matches()) bestPalindromeFound = searchText + reverse;
            }
        }
        JOptionPane.showMessageDialog(null, "The longest palindrome is \"" + bestPalindromeFound + "\".");
    }
}

Ce code est mauvais parce que:

• Il court dans le temps exponentiel à la taille du texte donné. Il s'exécute en énumérant toutes les chaînes de la forme az, en créant deux expressions rationnelles pour chaque chaîne générée et en testant l'entrée par rapport à chaque expression rationnelle.
• En outre, il échoue si le palindrome contient des lettres majuscules, des chiffres, du texte non ASCII, des signes de ponctuation, etc.
• Et bien sûr, regex n'est clairement pas le bon outil pour cela.

Python

Cela prend la chaîne et la réorganise sur le palindrome le plus long possible.

Par exemple:

Entrée: Bonjour

Ouput: lol

def get_palindrome(string):
    if len(string) == 0:
        return "I didn't catch that"
    list_of_characters = []
    occurances = []
    for character in string:
        if not character in list_of_characters:
            list_of_characters.append(character)
            occurances.append(1)
        else :
            occurances[list_of_characters.index(character)] +=1
    #check if a palindrome is possible
    if sum(occurances) == len(occurances): #no double letters, so only a one character palindrome
        return list_of_characters[0]
    first_half = ''
    second_half = ''
    middle_character = ''
    for index, character in enumerate(list_of_characters):
        number_of_occurances = occurances[index]/2
        first_half += character * number_of_occurances
        second_half = (character * number_of_occurances)+ second_half
        if (occurances[index]%2 != 0):#if there are an odd number, there will be one spare,
            #so put it in the middle
            middle_character = character
    return first_half + middle_character + second_half


print(get_palindrome(raw_input("String containing palindrome:")))

interprétation bioinformatique

Très cool question mec!

Les palindromes en langage normal ne sont pas clairement définis, par exemple si des espaces sont autorisés ou non. Donc, il n'est pas clair si ceux-ci devraient être autorisés ou non comme palindromes:

• Les oies voient-elles Dieu?
• Un homme, un plan, un canal - Panama!

Quoi qu'il en soit, je pense que vous vous référez à la signification scientifique plus précise du palindrome: pour qu'une séquence nucléotidique soit considérée comme un palindrome, son brin complémentaire doit lire la même chose dans la direction opposée. Les brins allant de 5 'à 3' et son brin complémentaire de 3 'à 5' doivent être complémentaires (voir ici ).

Des recherches sont en cours pour la reconnaissance de séquence palindrome et je pense que vous devriez vraiment lire au moins ceci . Pour résoudre votre problème, vous pouvez copier leur approche! Le professeur envoie même le code source si vous le lui demandez.

Eh bien, passons maintenant au problème actuel. Supposons que vous ayez une séquence de nucléotides donnée sous forme de chaîne de caractères. La meilleure façon de trouver des palindromes dans une telle séquence consiste à utiliser des algorithmes standard. Je pense que votre meilleur pari utilise probablement cet outil en ligne: http://www.alagu-molbio.net/palin.html

Étant donné que vous devez fournir une fonction qui effectue la tâche, vous devez réfléchir à la manière d'obtenir votre chaîne dans cette application? Eh bien, le plaisir commence. Je pense que vous pourriez utiliser le sélénium pour cela. Puisque je ne veux pas faire tes devoirs, je te donne juste l’idée de base. En Java, le monde commence comme ceci:

package testing;

import java.util.regex.Matcher;
import java.util.regex.Pattern;

import org.openqa.selenium.By;
import org.openqa.selenium.WebDriver;
import org.openqa.selenium.WebElement;
import org.openqa.selenium.phantomjs.PhantomJSDriver;

public class PalindromeService {


    public static void main(String[] args) {
        WebDriver d1 = new PhantomJSDriver();

        d1.get("http://www.alagu-molbio.net/palin.html");

        String sequence = "AAGTCTCGCGAGATCTCGCGAGATCTCGCGAGATCTCGCGAGAAA";

        WebElement txtArea = d1.findElement(By.tagName("textarea"));

        txtArea.sendKeys(sequence);

        WebElement send = d1.findElement(By.cssSelector("input[type=submit]"));
        send.click();

        String result = d1.findElement(By.tagName("body")).getText();

        Pattern p = Pattern.compile(".*capitalized\\.[^agctACGT]*([agctACGT]+).*");
        Matcher m = p.matcher(result);
        if (m.find()){
            result = m.group(1);
        }

        //now you have all palindromes in upper case! 
        //I think you can take it from here, right?

        System.out.println(result);

        d1.quit();
    }
}

Si vous êtes intéressé par les langues palindromes, vous pouvez utiliser la même technique avec d’autres services Web tels que http://www.jimsabo.com/palindrome.html ou http://calculator.tutorvista.com/math/492/palindrome-checker. .html

techniques de contrôle de code

• omettez les sources vraiment utiles telles que http://rosettacode.org/wiki/Palindrome_detection

• bla intéressant mais inutile de la bioinformatique

• délibérément mal comprendre cela comme tâche de bioinformatique

• triche - pour résoudre le problème, un service Web est utilisé

Python

def get_substrings(a_string):
    """Get all possible substrings, including single character substrings"""
    for start_index in range(len(a_string)):
        for end_index in range(start_index + 1, len(a_string) + 1):
            yield a_string[start_index:end_index]

def get_longest_palindrome(a_string):
    """Find the longest palindrome in a string and return its index or -1"""

    # Initialise variables
    longest_palindrome = get_longest_palindrome.__doc__[5:27]
    palindromes_list = []

    # Search string for all palindromes
    for substring in get_substrings(a_string):
        if reversed(substring) == substring:
            palindromes_list.append(substring)

    # There should always be palindromes in non-empty strings (single characters),
    # but it's good practice to check anyway
    if len(palindromes_list) > 0:
        longest_palindrome = max(palindromes_list, key=len)

    return a_string.find(longest_palindrome)

La chaîne "le plus long palindrome" est extraite de la docstring dans longest_palindrome.

La reversed()fonction renvoie un itérateur, reversed(substring) == substringelle ne sera donc jamais vraie et longest_palindromene sera jamais écrasée.

Par conséquent, la fonction trouvera littéralement "le plus long palindrome" dans une chaîne.

Javascript

Oh, c'est facile;). Voilà

function () {
    var palidrome = "Star? Not I! Movie – it too has a star in or a cameo who wore mask – cast are livewires.

Soda-pop straws are sold, as part-encased a hot tin, I saw it in mad dog I met. Is dog rosy? Tie-dye booths in rocks.

All ewes lessen ill. I see sheep in Syria? He, not I, deep in Syria, has done. No one radio drew old one.

Many moths – I fondle his; no lemons are sold. Loot delis, yob, moths in a deli bundle his tin. Pins to net a ball I won – pins burst input. I loot to get a looter a spot paler. Arm a damsel – doom a dam. Not a base camera was in a frost, first on knees on top spot. Now a camera was a widened dam.

Ask: Cold, do we dye? No, hot – push tap, set on to hosepipe. Nuts in a pod liven.

A chasm regrets a motto of a fine veto of wars. Too bad – I all won. A sadist sent cadets – a war reign a hero derides. A bad loser, a seer, tossed a cradle – he begat to cosset – a minaret for Carole, Beryl, Nora. We’re not as poor to self.

I risk cold as main is tidal. As not one to delay burden, I don’t set it on “hot”. A foot made free pie race losses runnier. As draw won pull, eye won nose. Vile hero saw order it was in – even a moron saw it – no, witnessed it: Llama drops – ark riots. Evil P.M. in a sorer opus enacts all laws but worst arose. Grab a nosey llama – nil lesser good, same nicer omen.

In pins? No, it is open. If a top spins, dip in soot.

Madam, as I desire, dictates: Pull aside, damsels, I set a rag not for a state bastion. A test I won e.g. a contest I won.

Kidnap, in part, an idle hero. Megastars, red, rosy, tied no tie. Blast! A hero! We do risk a yeti’s opposition!

He too has a wee bagel still up to here held.

Demigods pack no mask, cap nor a bonnet, for at last a case is open – I left a tip – it wets. A dog wets too. Radios to help pay my tip, pull a tip.

Ale, zoo beer, frets yon animal. Can it? New sex arose but, we sots, not to panic – it’s ale – did I barrel? Did I lose diadem, rare carrot in a jar of mine? Droop as tops sag – unseen knots.

A cat ate straw as buck risk cud; evil foe, nil a red nag ate? Bah! Plan it – silage. Model foot in arboreta.

I, dark Satanist, set fire – voodoo – to slat. I design a metal as parrot, I deem it now. One vast sum is no ten in set – amen! Indeed, nine drag a yam, nine drag a tie. Dame nabs flower; can we help man? Woman is worse nob.

Mud level rose, so refill a rut. A nag of iron I made to trot I defied – I risk leg and its ulnae. Can a pen I felt to bid dollar or recite open a crate, open a cradle, his garret?

Sample hot Edam in a pan. I’m a rotten digger – often garden I plan, I agreed; All agreed? Aye, bore ensign; I’d a veto – I did lose us site. Wool to hem us? No, cotton. Site pen in acacias or petals a last angel bee frets in.

I met a gorilla (simian); a mate got top snug Noel fire-lit role. Manet, Pagnol, both girdle his reed bogs.

Flan I reviled, a vet nods to order it, Bob, and assign it. Totem users go help mates pull as eye meets eye. Son – mine – pots a free pie, yes? No. Left a tip? Order a dish to get. A ring is worn – it is gold. Log no Latin in a monsignor, wet or wise. Many a menu to note carrot.

Cat in a boot loots; As I live, do not tell! A bare pussy, as flat on fire, I know loots guns, fires a baton, nets a hero my ale drop made too lax.

If it is to rain, a man is a sign; I wore macs, no melons rot. I use moths if rats relive, sir, or retire.

Vendor pays: I admire vendee, his pots net roe. Nine dames order an opal fan; I’ll ask cold log fire vendor to log igloo frost. Under Flat Six exist no devils.

Marxist nods to Lenin. To Lenin I say: “Mama is a deb, besides a bad dosser.”

Gen it up to get “ova” for “egg”. I recall a tarot code: yell at a dessert side-dish sale. Yes/nos a task cartel put correlate: E.S.P. rocks a man. I am a man, am no cad, I’m aware where it’s at!

Fire! Its an ogre-god to help, man, as I go. Do not swap; draw, pull a troll!

It’s not a cat I milk – calf, for a fee, sews a button – knit or tie damsel over us. Mined gold lode I fill until red nudes I met in a moor-top bar can. I sit, I fill a diary – trap nine men in ten-part net – oh, sir, I ask, cod nose? No, damp eel.

So, to get a name! I say, Al! I am Al! Last, I felt, to breed, deer begat.

To can I tie tissue – damp – or deliver Omani artist – a man of Islam.

In a den mad dogs lived on minis a signor who lived afore targets in at. As eremites pull, I, we, surf, fantasise, mend a bad eye. No hero met satyr; Tony, as I stressed, won’t, so cosset satyr.

A vet on isles made us sign it, a name. Foe man one sub.

Aside no dell I fret a wallaby; metal ferrets yodel, like so. On a wall I ate rye. Bored? No, was I rapt! One more calf? O.K., calf, one more, bossy! No! Lock cabin, rob yam, sip martini. Megastar was in a risk.

Cat? No, I’m a dog; I’m a sad loyal pet. A design I wore – kilts (a clan); if net drawn, I put it up. Royal spots snag – royal prevents rift.

Composer, good diet, are both super, God – label it a love of art, lustre. Video bored, no wise tale e.g. a mini tale – no sagas seen. Knack: cede no foes a canal.

Pay – as I sign I lie; clear sin it is; e.g. “Amadeus” sign I – lira for ecu, decimal – sin as liar.

Trad artistes pull a doom, a drawer won’t.

Is it sold loot? No, I suffered loss. A man is god; Amen! I came nice Tahiti (sic).

It’s ale for a ban if for a fast – is role to help mash turnip? Use zoo? No – grasp order – use no zoos. Warts on time did sag.

No grade “X” “A” Level? Oh, “A”! I’d a “B” or a “C”. So – pot? No, we lop. Date? Take no date! Bah! Play L.P.

Miss (a lass, all right?) flew to space in NASA era. Rose no (zero) cadets ate raw. As a wise tart I fined rags red Lenin, we help pay bet – a risk – cash to Brian. I put a clam in a pool – a pool wets.

Mahdi puts a stop to harem – miss it in one vote, lost in one, veto of none. Post-op, no tonsil; I ate; no tastier, eh? We sleep at noon time so I dare not at one; no time stops as I time tides. A bed: under it, roll; in a mania, panic!

In a pond I did as Eros as Lee felt tenrec. “Ink” – list it under “I”. Termites put pen in a way. Democrats wonder, I too. To slay moths a dog did.

I saw elf; elf, far now, is a devilish taboo, rag-naked. I hid a bootleg disc. I, saboteur, toss it in. Oops! No legs! Laminated, a cask, conker in it, negates all if it is simple.

Hot pages are in a mag, nor will I peer, familiar tat, so lewd, native rot. Toner, ewe wore no trace; vagabond ewes do. Oh, Ada! Have pity! A pitiable eel – “Oh wet am I!” – to save, note: bite gill as I do.

Call a matador minor, eh? As I live, don’t! Is torero no rigid animal debaser if tipsy? Ale drew esteem in a matador. A bolero, monks I rate play or go dig rocks; a can I step on.

Go! Gas – it evades a bedsit – set a roost on fire. Boss sent a faded eclair to green imp or dog, I’d don a belt to boot it; if Ada hid a boot, panic.

I mock comic in a mask, comedian is a wit if for eventide. Vole no emu loved is not a ferret, so pet or witness a weasel if not. I hired less, am not so bossy, as yet amateur.

To stir evil, Edna can impugn a hotel: bad loos, hot on Elba: I may melt. Tart solicits it rawer, gets it rare. Push crate open; I ram buses, use no trams.

Did I say, not to idiot nor a bare ferret, to trap rat, strap loops rat? Stewpot was on. Hot? I was red! Lessen it! Fine man on pot? No, pen inside by a bad law. So I made rips – nine delays.

Some Roman items in a.m. ordered “Is room for a ban?” “It is,” I voted: I sat pews in aisle. Beryl, no tiro to my burden, made off for a contest, I won kiss. I may raid fine dales. I raid lochs if I to help am.

Forecast for Clare v. Essex: If no rain, a man is ref. Fusspots net foxes.

Senor is a gnome, latinos’ bad eyesore. Help misses run to border, Casanova, now, or drab hotel.

Ma has a heron; I sleep, pet’s on nose, sir! Rev. I rag loved art live – fine poser. Ultra-plan: I feign, I lie: cedar to disperse – last one? No, last six. Enamel bonnet for a dark car to toss a snail at. In it all, Eve lost; Seth’s a hero slain on a trap – Rise, Sir Ogre Tamer.

Upon Siamese box I draw design. I, knight able to help, missed an alp seen in Tangier of fine metal pots. Tin I mined rages – order nine, melt ten. Tone radios; tones are not to concur. Ten-tone radar I bomb – best fire-lit so hostel side meets eerie mini red domicile. A gulf to get is not a rare tale; no time to nod.

Row on, evil yobs, tug, pull. If dogs drowse, fill a rut. An era’s drawers draw. Put in mid-field in a band I dig a tub deep. Staff on a remit did refill a minaret.

Sam’s a name held in a flat, or, sir, bedsit. I wonder, is it illicit ore? No ties? A bit under? Retarded? Is ‘owt amiss? I’m on pot; not so Cecil, a posh guy a hero met. A red date was not to last so Cecil sat.

Tip? An iota to pay, a dot; sad, I drop item. I’d ask, call, Odin, a Norseman’s god: “Pay payee we owe radio dosh o.n.o.” I to me? No, I to media.

Peril in golf – is ball a “fore”? K.O.!

Vexed I am re my raw desires. Alto has eye on nose but tone-muser pianist is level-eyed. I lost a tie. Blast! In uni no grades are musts. Avast! Never port! Sea may be rut.

Part on rose? – It’s a petal. Define metal:

Tin is . (I gulp!) can!

I am a fine posse man, I pull a ton. Ron, a man I put on, I made suffer of evil emu’s sadism. Leo’s never a baron – a bad loss but evil – topple him, Leo’s lad. Assign a pen, can I? A pal is note decoding.

Is damp mule tail-less? No, ill; I breed for its tone. Radio speed, to grower, grew. Open a lot? No, stamp it; if for a free peso – not ecu -deign it. Times ago stone rates, e.g. at Scilly, display a wont.

No wish to get a design I, Sir Des, I’ve let? No bus sees Xmas fir. O.K. – cab – tart it up; tie lots – diamond, log or tinsel; first end errata edit. So “le vin (A.C.)”, Martini, Pils lager, one tonic.

I pegged a ball up to here when I got a top star role, Beryl. Gun is too big – won’t I menace? Yes? No?

Ill? A cold? Abet icecap’s nip. U.S.A. meets E.E.C. inside tacit sale – see! Beg a cotton tie, ma! No trial, so dodo traps exist. Arabs under-admire card label good hood stole.

In rage erupted Etna. Will a rotunda, bare villa, to tyro. Lack car? Non-U! Get a mini! My, my, Ella, more drums per gong; get a frog – nil less. Rod, never ever sneer. Got to?

I disperse last pair of devils (ah!) here today or else order cash to breed emus. Said I: “Are both superlative?” C.I.D. assign it lemon peel still. I wore halo of one bottle from a ref (football) – a tip; so hit last ego slap a mate got.

Late p.m. I saw gnu here (non-a.m.) or an idea got a dog to nod – I made felt to boot.

Fill in a lad? Nay, not all, Edna – lash to buoy. Did you biff one Venus? Not I! “Broth, girl!” ladies ordered – “No, with gin!” – a fine plate, maybe suet; no carton I made rots in it.

Med: a hill, Etna, clears in it. Ali, Emir, to slap in/slam in. All in all I made bad losers sign it – alibi. Set a lap for a level bat.

A bed, sir, eh? To put cat now? Drat! Such an idyll of a dog’s lair! That`s it, open it – a cage! Big nit sent rat! Some day (A.D.) send ewe. No, draw a pot now, do! Of wary rat in a six ton tub.

Edna, ask satyr: “Tel. a.m.?” No, tel. p.m.; Israeli tuner is damp. Use item: “Anna Regina”. No! Dye main room (“salle”) red!

Nice caps for a sea cadet in U.S.A. – Now I, space cadet, am it, sea vessel rep. Pin it on Maria, help Maria fondle her fine hotpot. No! Meet; set up to net, avoid a lesion. Set acid arena: Bruno one, Reg nil. Like it to sign in? Even I am nine-toed! I vote votes.

Oh, can a nose-rut annoy? No, best is Dorset. I know, as liar, to snoop, malign. “I’ll order it to get a bedroom door,” began a miser I fed.

Am I to peer, fan? Is a door by metal? Ere sun-up, drowse, nod, lose magnet. Food? Buns? I’ll ask. Corn? I’ll ask. Corn – I snack. Cats snack (cold rat). Sum for a bag: nil. First, is remit “traps in net”? Yes, on a par. Coots yell over a dam I made. Bared nudist went a foot, I made roots. I tip a canon: “Row, sir, at same tide; man one: row tug.”

Sewer of denim axes a wide tail – a terror recipe to hero made manic. I, to resign? I ? Never!

“OFT I FELT ITS SENSUOUSNESS” – title fit for evening is erotic; I named a more hot epic – error retaliated – I was examined for ewe’s gut, wore no named item.

A star is worn on a cap, it is too red. Am I too fat? Newts I’d under a bed. Am I mad? Are volleys too crap? A nosey tennis part-timer sits rifling a bar of mustard.

Lock cans, stack cans in rocks, all in rocks, all I snub. Do often games, old ones, word-pun use; relate, my brood, as in a free pot I made fires, I manage brood. Moor debate got tired rolling, I lampoon, so trail saw on kites.

Rod sits, ebony on nature, so Nana chose to veto video. Ten in main evening is O.T.T. i.e. killing; Ere noon, urban eradicates noise, lad, I ovate not. Put esteem on top (to hen, if reheld).

No fair ample hair – am not I nipper-less? Eva estimated ace caps I won as united. A Caesar of space, Cinderella’s moor, Niamey Don (a Niger-an name), ties up mad sire, nut! I, Lear, simpleton male, try tasks “A” and “E”

but not “XI”. Sanitary raw food won top award one Wednesday – a demo.

Start nesting, I beg a cat. I? Nepotist? Ah, trials, God! A folly, Dinah, custard won’t act up; other is debatable. Velar: of palate; sibilating is “s”.

Resold: a bed, a mill, an ill animal – snip, also trim. Eilat in Israel can tell I had ‘em. Tin I stored (am I not raconteuse?) by a metal pen. If a night, I wondered, rose, I’d all right orbit on sun, even off.

I buoy, did you? Both Sal and Ella, Tony and Alan (“Ill if too bottle-fed, am I?”) do not. God! A toga! Ed in a Roman one, rehung! Was I, M.P. et al., to get a map? Also get salt? I, hospital lab to offer, am, or felt to be, no fool – a hero.

Will it sleep? No, melting is sad ice. Vital re-push to be raid, I assume. Deer, both sacred roes, Leroy (a doter, eh?) has lived for. I, apt sales rep’s idiot to greens, revere vendors selling or fat egg-nog reps.

Murder O’Malley, my mini mate – gun on rack. Calory total: liver, a bad nut or all I wanted (“et puree garnie”): lots. “Do, oh do, ogle bald racer,” I’m dared – N.U.S. bar at six.

Esparto, dodo’s lair to name it, not to cage bees, elasticated, is nice. Esteem, as up in space, cite bad local lions, eye can emit now. G.I. boots in ugly rebel or rat’s potato gin (eh?) were hot. Pull a bad egg – epic, I note, no regal slip in it. Ram can . (I’ve lost idea!)

Tarred nets, rifles, nitro, gold – no maid stole it. Put it, rat, back or if Sam (“X”) sees sub on televised rising, I sedate Goths. I won’t – no way.

Alps, idyllic stage set, are not so gas-emitting, I educe. To nose, peer, far off, I tip mats onto lane. Power grew or got deep so I dare not stir. Of deer, billions sell. I ate lump – mad sign, I do cede – tonsil a pain, acne pang is sad also. Elm I help pot, live – tub’s sold; a ban or a bar, even so, elms, I’d assume, live for. Effused am I not, up in a manor, not all up in a mess.

Open if a main A.C. plug is in it.

Late men I fed late – pasties or not. “Rapture” by a maestro prevents a vast sum erased.

Argon in units, albeit at solid eye level, sits in a . (I presume not) . tube, son. No eyes: a hot laser – is Ed wary?

Mermaid, ex- evoker of all A.B.s, I flog. Nil I repaid. Emotion! Emotion, oh so do I dare, woe!

Wee yap-yap dog’s name’s Ron. An idol lacks a dime tip, or did, as today a potato in a pitta slice costs a lot – tons. A wet adder ate more hay. Ugh! So, pal, ice cost on top? No, miss, I’m a two-sided rat, erred nut, I base it on erotic ill; It is I, red now; it is debris, rot.

Alf, an idle he-man as “master animal lifer” did time, ran off at speed, but a G.I. did nab an idle if dim nit. Upwards rewards are natural life’s words, God. Fill up guts, boy, live now or do not emit one later. A rat on site got flu.

Gaelic, I’m odd Erin, I’m Eire, esteemed islet. So hostile rifts ebb. Mob, I.R.A., dare not net R.U.C. – no cotton. Erase not, so I dare not nettle men in red rose garden – I’m in it.

Stop late men if foreign at nine. Esplanades, simple hotel, bath, gin – king is Edward IX; obese; Ma is no pure mater. Go! Rise, sir; part anon.

I also rehash tests – ‘O’ Level Latin, Italian. S.A.S., so, to track radar. Often nobleman exists alone – not sales reps – I do. Trade ceiling, i.e. final part, lures open if evil trade.

Volga River rises on no steppe. Elsinore has a hamlet – Oh, Bard, row on Avon!

A sacred robot nurses simple hero’s eye; dabs on it a lemon. Gas, iron, Essex often stops, suffers in a mania. Ron fixes several crofts, acer of maple. Hot, I fish; cold, I arise laden; if diary amiss, I know it set no car off. Foe-damned ruby motor, it only rebels.

Ian I swept aside to visit, in a bar of moorside red, Romanis met in a more mossy ale den. Inspired am I, Oswald. A bay bed is nine p on top. No name, niftiness- elder saw it. Oh no! Saw top wet star’s pool – part star, part otter. Refer a baron to idiot, Tony, as I did.

Smart ones use submarine.

Poet, arch-super-artiste, grew artistic. I lost rattle; my amiable, not oh so old, able to hang up, mina, can deliver it, so true. “Ta, matey!” – says so Boston (Mass.) elder I hit.

On file S.A.E. was sent – I wrote poster re fat on side, volume one – loved it, never off it, I was in. Aide mocks a manic; I mock comic, I nap: too bad I had a fit, I too. Bottle ban odd, I go drop mine, ergo trial ceded a fatness, sober if not so, or a test is debased.

A vet is agog – no pet’s in a cask – corgi dog, royal pet, a risk no more.

Lob a rod at a man I meet. Sewer delays pit fires – a bedlam in a dig – iron ore rots it. No devil is a hero – Nimrod.

At a mall a cod is all I get. I bet on Eva, so Tim ate whole eel bait, I pay tip, Eva had a hood sewed. No B.A. gave car to Nero, we were not to rev it and we lost a trail; I’m a free pill, I wrong a man. I erase gap; to help miss it, I fill a set. A gent in ire knocks a cadet.

Animals’ gel on spoon – it is so true to basics – I’d gel; too bad I hide kangaroo baths – I lived as I won raffle, flew as I did go, dash, to my, also too tired now, star comedy: A wan, inept, upset I’m retired, nut; its ilk, nicer. Nettle feels a sore; sad, I did no panic in a pain, am an ill or tired, nude, based item; it is a spot.

Semitone, not a tone, radios emit; no, on tape; elsewhere it’s a tone.

Tail is not on; pots open on foot, even on it, so let oven (on, it is) simmer – a hotpot’s a stupid ham stew.

Loop a loop, animal – cat up in air.

Both sacks I rate by apple hewn in elder’s garden if it rates, I was aware – tasted a core.

Zones or areas, Annie, cap, so twelfth girl, lass, alas, simply (alpha beta) done, Kate. Tadpole won top Oscar, Obadiah, “O” Level axed.

Argon gas did emit no straw, so ozone sure drops argon, oozes up in Ruth’s ample hotel or sits afar off in a bar – of elastic, is it?

I hate cinema; cinema dogs in a mass. Older effusion to old – lost, is it now? Reward: a mood.

All upsets it.

Radar trails an Islamic educer of a riling issue, damages it in Israel. Ceiling is, I say, a plan, a case of one deck. Can knees sag as one Latin image elates, I wonder?

Oboe diverts ultra foe, volatile bald ogre – push to berate; I’d do, ogre. So, p.m., Oct. first, never play organ’s stops – lay or put it up in ward ten.

Final cast like rowing – I sedate play, old as am I, God! Am I! On tacks I ran; I saw rats. A Gemini tramp is May born.

I back colony’s sober omen of lack of lace. Rome, not Paris, a wonder.

Obey retail law – a noose killed oyster. Reflate my ball, a water-filled one. Disabuse no name of emanating issue.

Damsels, I note, vary tastes so cost now desserts. I say no! Try taste more honeyed. A bad nemesis at naff ruse will upset. I, mere Satanist, e.g. rater of a devil – (Oh wrong is a sin!) – I’m no devil’s god, damned.

Animals, if on a mat, sit. Rain, a more vile drop, made us site it in a cottage. Breed deer – bottle fits a llama.

I lay, as I emanate, go to sleep, mad ones on docks – air is hot. Entrap, net, nine men in party raid – all if it is in a crab-pot room, an itemised, under-lit, nullified old log den – I’m sure voles made it rot in knot.

Tubas we see far off lack limit. A cat on still or tall upward paws to no dog is an ample hot-dog, ergo nastier if tastier, eh? We, raw amid a conman, a mama in a mask, corpse et al., err.

Octuple tracks at a son’s eyelash side distressed a tall eye doctor, a tall ace, rigger of a vote: got put in egress; odd, abased, is ebbed, as I am, Amy, asinine lot! Nine lots! Don’t six rams live? Don’t six exist?

Alfred, nuts or fool gigolo, trod never if gold locks all in a flap on a red rose; made nine or ten stops.

I heed never, I’m Daisy, a prod never, I terrorise viler starfish. To me suitors, no lemons, came rowing. Is a sin a mania? Rot!

Sit! I fix a looted amp or delay more, hasten not. A baser if snug stool, wonkier, if not – Alf says – super, a ballet to no devil, is a stool too. Ban it, actor, race to no tune.

May names I wrote wrong (Is no man in it, a long old log?) sit in row, sign irate Goths; I dare drop it. At felon’s eye I peer, fast open – I’m nosey, esteem eyes. All upset, ample hogs resume totting. Is sad nabob tired? Roots don’t evade liver in Alf’s gob.

Deers I held right; oblong, apt enamel or tile rifle on gun spot to get a man – aim is all. I rogate, minister. Feeble gnats, alas late, prosaic, a canine pet is not to consume hot.

Loo, wet, issues old idiot; evading, I sneer, obey a deer, gall a deer, gain alpine dragnet for egg I’d net to ram in a pan I made to help master. Rags I held, arcane poet, arcane poetic error, all odd; I bottle fine panacean lust. I’d nag elks I ride if editor toted a minor. I fog a natural life.

Roses, or level dumb ones – rows in a mown, ample, hewn acre. Wolfsbane made it a garden in May, a garden indeed.

Nine mates, nine tons I must save now on time – editor raps a late man. G.I.s edit also, too. Do over if tests in a task radiate. Rob ran; I, too, fled.

“Omega” – list in alphabet.

A gander, a line of live ducks, irk cubs. A wart, set at a cast on knee, snug as spots.

A poor denim for a janitor, racer, armed aide, solid idler – rabid; I’d elastic in a pot, tons to sew.

Tubes or axes went in a clam, in an oyster. Free booze – lap it all up. Pity, my apple hot, so I’d a root stew. God, a stew! Tip it at feline! Posies, a cat’s altar often, no baron packs. A monk caps dog – I meddle here – hot? Pull its leg! A bee was a hoot, eh?

No, it is opposite. Yaks I rode wore hats, albeit on deity’s orders. Rats age more held in a trap, nip and I know it – set no cage now.

It’s eta; no, it’s a beta – Tsar of Tonga rates isles. Mad Ed is all upset at cider, is Ed? Is a madam too? Snip? I’d snip, spot a fine position, snip nine more cinemas.

Do ogres sell in a mall? Yes, on a barge so rats row tubs.

Wall last canes up or Eros, an imp, lives to irk, rasp or dam all tides sent. I won’t – I was no Roman – even I saw tired row – a sore. He lives on. “No!” we yell.

Up, now! Wards are in nurses’ sole care. I, peer, fed, am too fat? Oh, not I, test no dined ruby ale; dote not on salad it’s in – I am sad.

Locks I rifle so troops atone re war. Only rebel or a crofter animates so cottage beheld arcades, so trees are sold, abased. I redo, rehang, I err – a wasted act; nests I’d – as an owl – laid. A boot’s raw foot, even if a foot to master, germs (ah!) can evil do.

Pan is tune-pipe – so hot notes, paths up to honeydew.

Odd locks, a maddened (I was aware) macaw on top, spot no seen knots, rifts or fan, I saw. Are maces a baton, madam? Oodles, madam? Rare laptops are too late – got too lit up.

Nits rub – snip now, I’ll abate, not snip, nits I held.

Nubile Danish tomboys I led to old loser as no melons I held; no fish to my name. Nod lower, do I dare? No, one nods a hairy snipe. (Edit: one hairy snipe, eh?) See silliness, else we’ll ask cornish to obey deity’s or god’s item. I, God, damn it! I was in it! To Hades, acne trap, sad loser! As warts pop, a dosser I – we – vile rat, sack! Same row, oh woe! Macaroni, rats, as a hoot, tie. I vomit on rats.";
return '$system> KERNEL ERROR (DOES. NOT. EXCIST)'
}

:)

Ruby - La force brute (optimisée et monkeymized!)

Je trouve que le meilleur moyen de le faire est d'utiliser l'algorithme bien connu de Monkey, vous pouvez probablement le trouver dans BOOST. Ils ont toujours eu le moyen de vous faire parler ...

def palindrome?(in)#IMPORTANT
  if in.reverse == in
    return true
  else
    return false
end

def getMonkeys(in)#don't forget to interface with C in case of
  MaxMonkeys = 0
  MonkeyTalk = ""
  MonkeySpeed = in.length
  (0..MonkeySpeed).each do |monkeyA|
    (monkeyA..MonkeySpeed).each do |monkeyB|#optimized!
      if palindrome?(in[monkeyA..monkeyB]) do
        if in[monkeyA..monkeyB].length > MaxMonkeys do
          MonkeyTalk = in[monkeyA..monkeyB]
        end
      end
    end
  end
  MonkeyTalk
end

Ceci est extrêmement inefficace, mais plutôt mignon et semblable à un rubis si vous renommez tous leurs noms d'origine: MaxMonkeys = len; MonkeyTalk = résultat, MonkeySpeed ​​= strlen; singeA: a; monkeyB: b; getMonkeys: getMaxPalindrome.
Cela n’a aucune valeur pour le PO et le risque de décider d’interfacer réellement avec C, et nous savons tous comment cela se termine ...

Python 2.7

Je refuse d'utiliser les fonctions standard, car elles sont inefficaces. Tout le monde sait que la meilleure façon de rechercher une longueur est d'avoir une table à référencer. Je crée donc une table de tous les palindromes possibles et je les trie à l'aide d'un bogosort pythonique, mais pour améliorer l'efficacité, je supprime d'abord les doublons. . À ce stade, je calcule tous les éléments qui sont des palindromes et les trie par longueurs. Vous pouvez alors simplement prendre la dernière longueur de la liste, qui a une recherche O (n) en itérant la liste.

Code:

from itertools import chain, combinations
from random import *
stringToTest = "abba"

#Don't forget to reference code taken from stackoverflow. (http://stackoverflow.com/questions/464864/python-code-to-pick-out-all-possible-combinations-from-a-list)
def FindAllSubsetsOfAString(StringToFindASubsetOf):
  return chain(*map(lambda x: combinations(StringToFindASubsetOf, x), range(0, len(StringToFindASubsetOf)+1)))

listOfPermutations = []

#get the length of the string we are testing, as the python function is not portable across platforms
lengthOfStringToCheck = 0
for currentCharacterInString in stringToTest:
    lengthOfStringToCheck = lengthOfStringToCheck + 1
lengthOfStringToCheckMinusOne = lengthOfStringToCheck - 1
#Always iterate backwards, it is more efficient for  cache hits and misses
for stringBeginningIndex in range(lengthOfStringToCheck, 0, -1):
    listOfPermutations.append(stringToTest[stringBeginningIndex:lengthOfStringToCheckMinusOne])

#To save from errors, we must not operate directly on the list we have, that would be inefficient. We must copy the original list manually.
# The built in functions again aren't portable, so we must do this manually, with a deep copy.
OtherListOfPermutations = []
for CurrentItemInOriginalList in listOfPermutations:
    TemporaryListItem = []
    for CurrentIndexInCurrentItemInOriginalList in CurrentItemInOriginalList:
        TemporaryListItem.append(CurrentIndexInCurrentItemInOriginalList)
    OtherListOfPermutations.append(''.join(TemporaryListItem))

#Get all of the possible strings into the OtherListOfPermutations List.
# Use Generators, and itertools. It's more efficient and more pythonic
for OriginalString in listOfPermutations:
    for CurrentPermutationInCurrentString in FindAllSubsetsOfAString(OriginalString):
      OtherListOfPermutations.append(''.join(list(CurrentPermutationInCurrentString)))

#Sort the list
ListOfStringsSortedByLength = OtherListOfPermutations
while not all(len(ListOfStringsSortedByLength[i]) <= len(ListOfStringsSortedByLength[i+1]) for i in xrange(len(ListOfStringsSortedByLength)-1)):
    shuffle(ListOfStringsSortedByLength)

#Remove all of the duplicates in the sorted list
ListOfStringsSortedByLengthWithoutDuplicates = []
for CurrentStringWorkingWith in OtherListOfPermutations:
    HaveFoundStringInList = False
    for CurrentTemporaryString in OtherListOfPermutations:
        if CurrentStringWorkingWith == CurrentTemporaryString:
            HaveFoundStringInList = True
            if(HaveFoundStringInList == True):
                ListOfStringsSortedByLengthWithoutDuplicates.append(CurrentStringWorkingWith)

#Use the ListOfStringsSortedByLengthWithoutDuplicates and check if any of the strings are palindromes
ListOfPotentialPalindromes = []
for TemporaryStringToUseForPalindromes in ListOfStringsSortedByLengthWithoutDuplicates:
    lengthOfStringToCheck = 0
    for currentCharacterInString in TemporaryStringToUseForPalindromes:
        lengthOfStringToCheck = lengthOfStringToCheck + 1
    if lengthOfStringToCheck != 0:
        TemporaryStringToUseForPalindromesReversed = TemporaryStringToUseForPalindromes[::-1]
        if TemporaryStringToUseForPalindromesReversed == TemporaryStringToUseForPalindromes:
            ListOfPotentialPalindromes.append(TemporaryStringToUseForPalindromes)

#Remove any duplicates that might have snuck in there
ListOfPotentialPalindromesWithoutDuplicates = []
for CurrentPotentialPalindrome in ListOfPotentialPalindromes:
    HaveFoundStringInList = False
    for CurrentTemporaryPalindrome in ListOfPotentialPalindromes:
        if CurrentPotentialPalindrome == CurrentTemporaryPalindrome:
            HaveFoundStringInList = True
            if(HaveFoundStringInList == True):
                ListOfPotentialPalindromesWithoutDuplicates.append(CurrentStringWorkingWith)

lengthOfPalindromes = []

for CurrentPossiblePalindrome in ListOfPotentialPalindromesWithoutDuplicates:
    CurrentPossiblePalindromeLength = 0
    for currentCharacterInPossiblePalindrome in CurrentPossiblePalindrome:
        CurrentPossiblePalindromeLength = CurrentPossiblePalindromeLength + 1
    lengthOfPalindromes.append(CurrentPossiblePalindromeLength)


while not all(lengthOfPalindromes[i] <= lengthOfPalindromes[i+1] for i in xrange(len(lengthOfPalindromes)-1)):
    shuffle(lengthOfPalindromes)

#find the last value in the list:
currentValue = 0
for currentPalindromeLength in lengthOfPalindromes:
    currentValue = currentPalindromeLength

print currentValue

Remarque

Pas vraiment adapté aux chaînes de plus de 4 caractères. Est-ce que "Abba" va bien, mais je suis allé acheter du café et un déjeuner cuisiné avant qu'il ne soit abcba

Problèmes:

Nom de variable insensé (et incohérent aussi)
Choix de l'algorithme ludique (Calculez toutes les permutations possibles de chaque sous-chaîne de la chaîne donnée, vérifiez si elles sont des palindromes, triez-les par longueur et recherchez la dernière valeur)
contient en fait la solution au problème

    TemporaryStringToUseForPalindromesReversed = TemporaryStringToUseForPalindromes[::-1] 

Un algorithme de tri stupide (bogosort) et une méthode nutjob pour assurer le tri de la liste.

De plus, il y a une erreur d'indentation dans la vérification des doublons qui ne fait rien du tout, c'est juste une perte de temps.

C

La recherche de palindromes est une opération difficile de PNP *, elle doit donc être effectuée avec un code hautement optimisé. Voici cinq astuces d’optimisation qui vous aideront à trouver la solution plus rapidement.

1. Commencez avec la bonne langue. Comme tout le monde le sait, "C" est le plus rapide.
2. Utilisez un algorithme rapide. BoyerMoore est le détenteur du record du monde de la recherche de chaînes, nous allons donc l'utiliser. Nous rechercherons également les chaînes les plus longues en premier afin d'avoir les meilleures chances de trouver une correspondance longue.
3. Connaissez votre processeur. Les ordinateurs modernes sont terriblement lents au niveau des branches de la if this else thatforme. (Au fur et à mesure que vous avancez dans votre carrière, vous devriez maîtriser la prédiction de branche si vous voulez être un vrai ninja de code.) Ce code évite le ifproblème de branchement en utilisant forplutôt des instructions qui vous donnent 3 instructions pour le prix d'un.
4. Faites attention au "Big-O". Cet algorithme n'utilise pas d'accolades dans les corps de fonction, empêchant ainsi les boucles imbriquées. Donc, le temps d'exécution doit être O (N).
5. N'oubliez pas les micro-optimisations. En utilisant la technique bien connue consistant à supprimer tous les espaces blancs entre les instructions, j'ai pu réduire la charge de travail du compilateur et gagner 10% de vitesse supplémentaire.

Mais ne lésinez pas sur les noms de variables, la lisibilité est importante.

^{* Palindrome-Pas Palindrome}

#define OFFSET 0XFF
#define ln(s) strlen(s) //macro to avoid runtime overhead

char* boyermore(char* needle, char* haystack){
  int i,k[OFFSET];
  for(i=0;i<OFFSET;i++)k[i]=ln(haystack);
  for(i=1;i<ln(haystack);i++)k[haystack[i]]=ln(haystack)-i;
  for(i=2;ln(needle)>=ln(haystack);needle+=k[needle[ln(haystack)]])
  for(i=ln(haystack)-1;needle[i]==haystack[i];i--)if(!i)return needle;
  return 0xFF-OFFSET;
}

char* reverse(char*src,char*dest,int loops){
  for(*(src+loops)=0;loops;src[--loops]=*(dest++));
  return src;
}

#define imax(a,b) ((a>b)?a:(b))
int main(int i, char*in[2]){
  char* is,*begin,*maybe,max=-1;
  char* end=in[-max],*start=end+ln(end);
  for(begin=malloc(start-end);--start>end;)
  for(i=start-end;i>0;i--)
  for(maybe=reverse(begin,start-i,i);boyermore(in[1],maybe);*maybe=1)
  for(;i>max;max=imax(i,max))is=start-i;
  for(maybe="found";max>0;max=-max) puts(reverse(begin,is,max));
}  

_{Outre les traces évidentes dans le commentaire, il existe plusieurs autres problèmes. L'algorithme de recherche est une implémentation valide de Boyer-Moore-Horspool, mais il ne stocke jamais les longueurs de chaîne, mais appelle strlen quelque chose comme N * M fois, ce qui le rend beaucoup plus lent qu'une simple recherche. "La recherche de la chaîne la plus longue en premier" est vraie, mais après cela, la recherche ne se fait pas par ordre de longueur, donc une sortie anticipée donnerait une mauvaise réponse, si elle était implémentée. Mais ce n'est pas, alors il recherche tous les N! possibilités quand même. Et presque tous les noms de paramètres (needle / haystack; src / dest) sont inversés par rapport à leurs significations standard.}

C'est ce que j'ai jusqu'à présent dans VB6:

Public Function strLongestPalindrome(ByVal strInput as String) as String

    strLongestPalindrome = ""
    Dim a as Integer
    Dim b as Integer

    For a = 1 To Len(strInput)
        For b = 1 to a
            Dim c as Integer
            Dim d as Integer
            c = a
            d = b
            Do
                If Mid$(strInput, c, 1) = Mid$(strInput, d, 1) Then
                    c = c + 1
                    d = d - 1
                    If c >= d Then
                        strPalindrome = Mid$(strInput, a, b-a+1)
                        If Len(strLongestPalindrome) < Len(strPalindrome) Then
                            strLongestPalindrome = strPalindrome
                        End If
                        Exit Do
                    End If
                Else
                    Exit Do
                End If
            Loop
        Next
    Next

End Function

Mais je ne pense pas que cela fonctionne et je pense pouvoir l'améliorer.

Voici une solution Java pour vous:

public String findLongestPalindrome(String s){
   if(s.equals("the longest palindrome")){
      return "the longest palindrome";
   }else{
      throw new IllegalArgumentException();
   }
}

AutoHotkey

;msgbox % longest_palindrome_in_string("racecar abcdedcba alkdf")

longest_palindrome_in_string(str){
l := Strlen(str) , max := 1
loop % l
{
    p := A_index
    loop % l-p
    {
        s := Substr(str, p, A_index+1) , k := ""
        loop, parse, s
            k := A_LoopField k
        if k = %s%
            if (sl:=Strlen(s)) > max
                out := s , max := sl
    }
}
return out
}

La fonction renvoie également des espaces car ils font partie d'une séquence palindrome d'une chaîne. Donc, ce qui précède revient <space>abcdedcba<space>.

Polyglotte

C'est à la traîne parce qu'il demande "de trouver le plus long palindrome d'une chaîne", c'est donc de trouver le plus long palindrome dans "une chaîne"

String palindrome(){
    return null; //There are no palindromes in "a string"
}

Je n'ai jamais su que les cordes pourraient contenir des palindromes, pouvez-vous me montrer où vous avez appris cela? Et si vous avez besoin du plus long palindrome, visitez ce site: http://www.norvig.com/pal2txt.html

Parcourez chaque caractère de la chaîne. Puis vérifiez les caractères avant et après ce caractère. Ensuite, les personnages deux avant et deux après ce personnage. Répétez jusqu'à ce que vous obteniez des personnages qui ne sont pas identiques. Cela vous permettra d'identifier la longueur de chaque palindrome dans le mot. Cependant, cette méthode ne fonctionnera que pour les palindromes de longueur impaire. Pour vérifier la présence de palindromes de longueur égale, vérifiez le caractère aux positions i et i-1, puis i + 1 et i-2, puis i + 2 et i-3, etc. J'espère que cela vous aidera!

La réponse évidente est de comparer la chaîne avec son propre inverse et de calculer la séquence commune la plus longue.

Le programme Perl suivant fait justement cela. Vous devrez peut-être télécharger le module Acme :: DonMartin, il n’est généralement pas installé par défaut.

use Acme::DonMartin;

sklush klikrunk skroik hee doodle shompah sproingdoink varoom hushle
fwiskitty twop pok zich frack gleep shloop zgluk zlitz faroolana deebe
fump kachoo zock fween boong pitooie oggock gahoff glip fwask padap fut
ooga chukkunk shkaloink kazash splosh sklizzorch fak ahh doom twop
beedoop gak wee fitzrower shkwitz shklik fweep spla gring glink splurp
thomp fwoof thoom kipf ging krunch blib ga kikatik bash dap thork huff
katoonk fak shik stoof dimpah skapasch skronch kachunka arargh sprat
gonk yip inkle blink fagwoosh fowm splapple blamp doomp ploom gishklork
shwik fomp plortch skroik gashplutzga plortch da goyng shtork borfft
zwot ping puffa trump thlip dig blonk thhhut splatch doonk sklizzorch
sprazot pwof slapth spashle kreek eck kik dit foing glukkle glikity
spazoosh plapf gashklitz mabbit boong sklortch swipadda sknikle phelop
skloshitty zat dokka splazitch tika zikka fling shooka glangadang
brrrapp fwizz gasploosh doop swish dikka splesh shooka blut galink
yeech caw tink sklitch shash tffp skrink poffisss oont spazoosh blort
aarh ting ho shpikkle shompah tood shkalink gloople skloshitty

Lua / Python

Lua est un langage très rapide (ce dont vous avez besoin, car il y a beaucoup de sous-chaînes à vérifier!), Mais Python est meilleur avec la gestion des chaînes. Alors pourquoi ne pas utiliser les deux?

Parce que j'ai entendu dire que c'est bien d'avoir des variables locales, j'en ai une. De plus, j'ai séparé les appels de fonction de leurs arguments, car trop d'arguments rendent les expressions encombrées et illisibles.

En outre, je pense que cela fonctionnera avec toutes les chaînes que vous voulez essayer. Il n'y aura probablement aucun problème avec des entrées étranges.

function is_palindrome()
    if os.execute("python -c 'exit(\"" .. is_palindrome_argument .. "\"==\"" .. is_palindrome_argument .. "\"[::-1])'") == true then
        return false
    else
        return true
    end
end

function longest_palindrome()
    local longest -- very important to use local variables
    for length = 1, #longest_palindrome_argument do
        for start_index = 1, #longest_palindrome_argument - length + 1 do
            is_palindrome_argument = string.sub(longest_palindrome_argument, start_index, start_index + length - 1)
            if is_palindrome() then
                longest = is_palindrome_argument
            end
        end
    end
    return longest
end

longest_palindrome_argument = "foo racecar"
print(longest_palindrome())

(BTW, vous ne croirez pas combien de temps cela m'a pris pour que cela fonctionne.)

Python one-liner:

s = "here goes your string"
print max(p for p in [s.lower()[j:i] for i in range(len(s) + 1) for j in range(len(s) + 1) if ' ' not in s[j:i] and s[j:i] != '' and len(s[j:i]) > 2] if p == p[::-1])

Python - 126 Caractères

Voici mon coup à ça:

k=[]
for i in range(len(p)):
 for j in range(i,len(p)):
  if p[i:j]==p[j:i:-1]:
   k.append(p[i:j+1])
k.sort(key=len)
k=k[-1]

Cela fonctionne à la fois dans Python 2.x et 3.x, je crois. La variable k contient la réponse.

EDIT: J'ai oublié de dire, la variable p devrait tenir la chaîne pour vérifier les palindromes.

Ceci est une implémentation légitime, donc cela fonctionnera pour n'importe quelle chaîne.

Java

Évidemment si aString s’agit d’un palindrome, aStringc’est le plus long palindrome de l’intérieur aString. Vous pouvez dire que cela fonctionne par la déclaration d'assertion. Ne pensez pas trop à la première ligne de code exécutable. Ce n'est que standard standard Java.

public CharSequence findLongestPalindromeInside(String aString)
{
       aString=new StringBuilder(aString).append(new StringBuilder(aString).reverse());
       assert isPalindrome(aString);
       return aString;
}

public boolean isPalindrome(CharSequence charSequence)
{
      return charSequence.toString().equals(new StringBuilder(charSequence).reverse().toString());
}

Langue Game Maker

var str,length,i,out,char;
str=argument0
out=""
length=string_length(argument0)
for(i=0;i<string_length(argument0);i+=1){
 char=string_char_at(str,length-i)
 out+=char
}
return argument0+out;

Fortran

Les chaînes sont trop difficiles à travailler en Fortran, j'ai donc choisi iacharde les convertir en entiers:

program long_palindrome
   implicit none
   character(len=100) :: string
   integer, dimension(100) :: fwd,rev
   integer :: i,j,fs,fe,rs,re

   print *,"enter string with palindrome hidden in it (max 100 characters)"
   read(*,*) string
   fwd = 0

! convert characters to ASCII integers
   do i=1,len(trim(string))
      fwd(i) = iachar(string(i:i))
   enddo

! reverse whole array
   j=len(trim(string))
   do i=1,len(trim(string))
      rev(i) = fwd(j)
      j = j-1
   enddo

! match strings of fwd and rev
   rs = 1; re = len(trim(string))
   fs = 1; fe = len(trim(string))

! test to see if whole thing is a palindrome
   if(all(fwd(fs:fe)==rev(rs:re))) then
      print *,"longest palindrome is "//string(fs:fe)//" with length",fe-fs+1
      stop
   endif

! nope? oh well, guess we have to loop through and find it
   fs = 0
   do
      fs = fs+ 1
      do fe = len(trim(string)),fs+1,-1
         do rs=1,fs
            re = fe-rs+1
            if(all(fwd(fs:fe)==rev(rs:re))) then
               print *,"longest palindrome is "//string(fs:fe)//" with length",fe-fs+1
               stop
            endif
         enddo
      enddo
      if(fs==len(trim(string))-1) exit
   enddo

   print *,"hmm, doesn't look like there was a palindrome of length > 1..."
end program long_palindrome

Cela ne fonctionne pas exactement. Étant donné la chaîne aabbaac, le plus long est aaindiqué, mais étant donné la chaîne acasdabbbaabb, le plus long est abbba. Assez proche.

Vous ne pouvez pas rivaliser sur le marché actuel en ne faisant que ce qui est demandé. Ce code trouvera également le palindrome le plus court et est insensible à la casse:

def flp(s):
    lp = 'the longest palindrome'
    sp = 'the shortest palindrome'
    return lp if lp in s.lower() else sp if sp in s.lower() else ''

>>> flp('xxxxthe longest palindromexxxx')
'the longest palindrome'
>>> flp('xxxxthe shortest palindromexxxx')
'the shortest palindrome'

Lua

function findPalendromes(str)
    str=str.." "
    ret_s=""
    for s in str:gmatch"(%w+)[ ]" do
        if s==s:reverse() and s:len()>ret_s:len() then ret_s=s end
    end
    return ret_s
end

L'implémentation Python la plus efficace qui surpasse tous les autres efforts:

def find_the_longest_palindrome(s):
    print "'the longest palindrome' found at : " + str(s.find("the longest palindrome"))

Remarques:

Cela trouvera toujours "le plus long palindrome"

C'est sensible à la casse.

Avec quelques modifications, il peut également être fait pour trouver d'autres chaînes. Cependant, vous devrez créer une classe, ajouter une méthode appropriée, puis la sous-classer pour chaque chaîne à trouver.

Cette fonction pourrait être améliorée en portant sur FORTRAN 77 ou en codant en dur dans le code machine Intel 8008.

Ceci est ma première réponse à la traîne de code. Ce n'est pas un troll particulièrement brutal, cela m'est apparu comme une façon idiote de répondre à la question.

private static String findLongestPalindrome(String input) {
    String longest = null;
    for (int i = 1; i <= input.length(); i++) {
        Matcher m = pattern(i).matcher(input);
        if (m.find()) {
            longest = m.group();
        }
    }
    return longest;
}

private static Pattern pattern(int len) {
    int size = len / 2;
    StringBuilder sb = new StringBuilder();
    for (int i = 0; i < size; i++) {
        sb.append("(.)");
    }

    if (len != size * 2) {
        sb.append(".");
    }

    for (int i = size; i > 0; i--) {
        sb.append("\\").append(i);
    }
    return Pattern.compile(sb.toString());
}

Les trolls sont:

• Créer manuellement le même motif à chaque fois
• Utiliser des références arrières coûteuses pour trouver des palindromes
• Itération de 1 à input.length () (en procédant à l’inverse, vous serez assuré que la première correspondance trouvée est la plus longue. Effectuer la procédure ci-dessus est stupide)

Python 3

from itertools import takewhile

def common_part(s1, s2):
    return sum(takewhile(bool, (a==b for a, b in zip(s1, s2)))) 

def palindromes(s):
    for i in range(1, 2*len(s)):
        m = i//2; n = i - m
        common = common_part(s[n-1::-1], s[m:])
        p = s[n-common:m+common]
        if p: yield p

string = input('> ')

print('Longest palindrome is', repr(max(palindromes(string), key=len)))

Programme très efficace. Il recherche les palindromes longs avec le centre dans des positions séquentielles (sur char et entre) et sélectionne le plus long.